Journal: The Journal of biological chemistry

Article Title: Transcriptional regulation of the mouse presenilin-1 gene.

doi: 10.1074/jbc.272.38.23489

Figure Lengend Snippet: FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse PS-1 cDNA as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized PCR primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.

Article Snippet: Briefly, a 50-ml PCR reaction containing a PS-1-specific reverse primer (TGGCTCAGGGTTGTCAAGTC, 0.2 mM), the CLONTECH AP1 adaptor primer (CCATCCTAATACGACTCACTATAGGGC, 0.2 mM), 2.5 ng of Marathon-Ready cDNA, 1 3 PCR buffer (Life Technologies, Inc.), MgCl2 (1.5 mM), dimethyl sulfoxide (5%), dATP, dGTP, dCTP, and dTTP (0.2 mM each), and Taq DNA polymerase (5 units, Life Technologies, Inc.) was used with a reaction cycle of 95 °C for 45 s, 55 °C for 30 s, and 72 °C for 90 s for a total of 30 cycles in the first amplification step.

Techniques: Cloning, Sequencing, Clone Assay, Plasmid Preparation